We use cookies to give you the best experience possible. By continuing we’ll assume you’re on board with our cookie policy

Chikungunya virus Essay

Abstraction

The revival of Chikungunya virus ( CHIKV ) in several parts of Thailand runing from southern, northeast and North of Thailand with reported instances about 30,000 instances, get downing in October 2008 and ongoing until now ( November 2009 ) , has pointed out the public wellness concern. The chief clinical characteristics are onset of febrility, icinesss, concern, myodynia, maculopapular roseola and terrible arthralgia. The four about complete genome, representatives of 2008 and 2009, have been determined. Our survey shows that the closest related to the isolate in this eruption were the isolates from Kerela, South India of 2008 ( RGCB80, Accession No. GQ428212 ) demoing two coding part permutations: nsP2-L539S and E2-K252Q and the strain which predominant is ECSA strain, in contrast of the all old eruptions in Thailand which were Asiatic strain.

Introduction

We will write a custom essay sample on Chikungunya virus specifically for you
for only $16.38 $13.9/page

Order now

Chikungunya Virus ( CHIKV ) is an enveloped, positive individual strand RNA virus with a genome of ? 11.8 kilobit [ 1 ] and belonged to the household Togaviridae and genus Alphavirus presently dwelling of 29 accepted members [ 2 ] . There is a 7-methylguanosine capped at the 5 ‘ terminal but a polyadenylated at the 3 ‘ terminal. The 5 ‘ two-thirds of the genomic RNA are responsible for the non-structural proteins. While the 3 ‘ tierce of the genomic RNA serves as the messenger RNA for the synthesis of the viral structural proteins [ 3, 4 ] . Harmonizing to the genomic organisation of other alphaviruses, the CHIK genome is acknowledged to be: 5 ‘ cap-nsP1-nsP2-nsP3-nsP4- ( junction part ) -C-E3-E2-6K-E1-poly ( A ) 3 ‘ . Alphaviruss have conserved sequences at the 5 ‘ and 3 ‘ terminals every bit good as the intergenic part. Among alphaviruses, conserved repeated sequence elements ( RSEs ) are besides observed in the 3 ‘ nontranslated part ( NTR ) . These conserved spheres play an of import function in the ordinance of viral RNA synthesis [ 5- 8 ] .

CHIKV causes Chikungunya febrility ( CHIKF ) and chief clinical features include sudden oncoming of febrility, icinesss, concern, myodynia, maculopapular roseola and terrible arthralgia, which mostly affect the carpus, articulatio genus, mortise joint and little articulations [ 9 ] . The febrility about invariably precedes the roseola and joint hurting and has infrequently been reported as biphasic with return noted on the 4th or 5th twenty-four hours of unwellness [ 10, 11 ] . No studies of biphasic febrility were described during the 2005–2007 eruptions. In past eruptions, instances of feverish paroxysms in immature kids were besides reported [ 12 ] . Maculopapular and erythematous in character of the non-pruritic roseola is typically found and it will be seeable after infection for 2-5 yearss and may last up to 10 yearss. This roseola is distributed chiefly on the face, limbs and bole of the organic structure. Possibly the most important symptom of CHIKV infection is the terrible articulation hurting that occurs with virtually every clinical instance [ 13, 14 ] . The patients who often reported disabling hurting that lasts for hebdomads or months have shown the articulations exhibiting enormous tenderness and swelling. Most infections wholly resolve within hebdomads or months but there have been documented instances of CHIKV-induced arthralgia prevailing for several old ages with up to 12 % of patients with CHIKV disease developing chronic articulation jobs [ 15- 17 ] .

CHIKV was foremost described from the serum of a fevered homo during an eruption in Tanganyika ( now Tanzania ) in 1952–1953 during an epidemic of dengue-like unwellness [ 10 ] . Serologic and antigenic word picture of the isolates suggested that it was an alphavirus closely associated to Mayaro and SFV, while the initial appraisal was that the eruption was because of a dandy fever virus [ 18, 19 ] . Retrospective instance reappraisals have proposed that CHIKV epidemics occurred every bit early as 1779 but were often described inaccurately as dandy fever outbreaks [ 20 ] . During the sixtiess and 1990s, the virus was determined repeatedly from several states in Central and Southern Africa including Sudan, Uganda, Democratic Republic of Congo ( DRC, officially Zaire ) , the Cardinal African Republic ( CAR ) , Malawi, Zimbabwe, Kenya and South Africa. CHIKV has besides been isolated in western African states including Senegal, Benin, the Republic of Guinea, Cote d’Ivoire and Nigeria [ 21 ] . The virus is believed to hold originated in Africa and later was introduced into many parts of Asia [ 20 ] . Phylogenetic analysis of the CHIKV genome based on partial E1 sequences has identified 3 line of descents ; West African, Asian and East, Central and South African ( ECSA ) lineages [ 22 ] .

In Africa, the virus is maintained through a sylvatic transmittal rhythm between wild Primatess and mosquitoes such as Aedes luteocephalus, Aedes furcifer, or Aedes taylori [ 23 ] while in Asia has been an urban transmittal rhythm, typically found in dengue-endemic countries and transmitted from human to human mostly by Aedes aegypti and, to a lesser extent, by Aedes albopictus [ 24 ] . The first CHIKV isolation in Asia was in Thailand in 1958 [ 25 ] and so other eruptions have been documented including Cambodia, Vietnam, Laos, Myanmar, Malaysia, Philippines, and Indonesia [ 23 ] Beginning in 1986, CHIKV outbreaks resurged with major disease bunchs documented in Senegal in 1986 and 1996/1997 [ 24 ] , Ivory Coast in 1996/1997 [ 26 ] , DRC during 1998–2000 [ 27 ] , Indonesia in 2003 [ 28 ] . Outbreaks occurred about continuously during 2004–2007 with 100s of 1000s of reported instances and new geographical countries involved [ 21 ] such as Kenya in 2004, Comoros in 2005 [ 29 ] , several Indian Ocean islands, in 2005, and India, in 2006-2007, which was an eruption of unprecedented magnitude [ 30 ] . Cases were besides reported in Europe ( UK, Belgium, Germany, Czech Republic, Norway, Italy, Spain and France ) , Hong Kong, Canada, Taiwan, Sri Lanka and the USA ; these were straight associated with the return of tourers from India and affected islands of the Indian Ocean [ 31 ] . The prevailing Aedes species in Madagascar and Reunion islands during 2005–2006 and in India in 2006/2007 was Aedes Albopictus [ 32 ] . The spread of chikungunya into rural countries during the ulterior phases of eruptions in India farther confirmed the potency of Aedes albopictus mosquitoes in conveying CHIKV [ 33 ] . These alterations were coincident with the outgrowth of a strain holding an alanine to valine permutation at codon 226 ( A226V ) of the envelope 1 ( E1 ) cistron in Reunion Island [ 34 ] and India [ 35 ] . This mutant is known to increase the transmissibility of the virus by Aedes albopictus [ 36 ] . This incident has been documented with the equid avirulent, Venezuelan equine phrenitis subtype ID viruses, where every bit small as 7 amino acid alterations can make epidemic forms of the virus responsible for immense eruptions [ 37 ] .

The late September to October 2008, CHIKF eruptions have arisen in many southern states of Thailand particularly in Narathiwat, the southernmost state. There are plentifulness of Aedes Albopictus, the vector for CHIKV, in the plantation country, the common country of southern Thailand, and CHIKV was isolated from Aedes Albopictus in this outbreak country every bit good [ 38 ] . The suspension of CHIKF may be due to failure to observe low degree, continued transmittal in worlds, peculiarly because the symptoms may be mistaken for dandy fever febrility plus there is no accredited vaccinum or specific drug therapy available to bring around the unwellness, intercession relies upon vector control and minimising mosquito-human contact.

Although there are several complete genomes of CHIK available in GenBank, the complete nucleotide sequence of CHIK distributing in Thailand is non available. In this survey, we conducted the about complete nucleotide sequence of virus isolated from four serum in 2008 and 2009, from Narathiwat state, the southernmost of Thailand and Bangkok where forbearance returned back from Nakhonsrithammaraj, the South of Thailand, inside informations were provided in table 1. In add-on, the phyletic beginning and the diverseness of the CHIKV strains responsible for reemergence in Thailand are besides considered.

Method

RNA extraction and RT-PCR

CHIKV have been isolated straight from the patient ‘s sera or from cell civilization which came from Vero cell at the first transition and the inside informations of sample were provided in table 1. Viral RNA were extracted by Viral Nucleic Acid Extraction Kit ( RBC Bioscience, Taiwan ) harmonizing to maker ‘s process followed by contrary written text polymerase concatenation reaction ( RT-PCR ) utilizing Superscript III Pt One-Step Quantitative RT-PCR System ( Invitrogen, Carlsbad, CA, USA ) . A reaction mixture consisted of 2 ?l of extracted RNA, 5 ?l of 2x reaction mixed, 0.1 ?l of superior contrary RNA polymerase III Pt Taq polymerase, 0.5 ?M of each primer, and 6 ?l with nuclease-free H2O. The RT measure and PCR elaboration were performed in a Eppendorf Mastercycler personal ( Eppendorf, Hamburg, Germany ) at one time under the undermentioned conditions: contrary written text at 50 C for 30 min ; later initial denaturation at 95 C for 3 min ; followed by 40 rhythm of denaturation at 95 C for 1 min, primer tempering at 55 C for 1 min, and extension at 72 C for 1.30 min ; and concluding extension at 72 C for 7 min. All primers were used as show in table 2 which was designed towards S27 strains ( GenBank accession no. AF369024 ) [ 35 ] . Then the amplified PCR merchandises were analyzed by cataphoresis with 2 % -agarose gel in TBE buffer and stained by ethedium bromind, the expected set for the merchandise were visualized under UV visible radiation, excised from the gel and purified with the QIAquick Gel Extraction kit ( RBC Bioscience, Taiwan ) following the maker ‘s instructions. The purified PCR merchandises were so used for direct sequencing by First BASE Laboratories SDN BHD ( Selangor Darul Ehsan, Malaysia ) .

Table 1 Sample inside informations used in this survey

sample codification

day of the month of aggregation

topographic point

GenBank Acc No

sample type

CU-Chik661

2009

Narathiwat

biological sample

CU-Ckik009*

2009

Capital of thailand

biological sample

CU-Ckik10

2008

Narathiwat

biological sample

CU-Chik683

2009

Narathiwat

virus isolate

*patient returned from Nakhonsrithammaraj, the state in the South of Thailand.

Table 2 Primers used for whole genome sequencing

fragment

cistron

primer ( a )

Sequence ( 5 ‘ to 3 ‘ )

1

5’NC

18F

CACGTAGCCTACCAGTTTCTTA

nsP1

871R

ATGGAACACCGATGGTAGGTG

2

nsP1

616F

AACCCCGTTCATGTACAATGC

nsP1

1435R

CGGTACCACAAAGCTGTCAAAC

3

nsP1

1317F

CACTGACCTGCTGCTGTCTATG

nsP2

2130R

AGTCCTGCAGCTTCTTCCTTC

4

nsP1

1412F

CGAGTTTGACAGCTTTGTGGTA

nsP2

2227R

ATGACTGCAATTTTGTATGGGC

5

nsP2

1908F

CAATCTCGCCTGAAGACTTCC

nsP2

2709R

TCCACTACAATCGGCTTGTTG

6

nsP2

2530F

GTGCGGCTTCTTCAATATGATG

nsP2

3343R

TCCAGGCCTATTATCCCAGTG

7

nsP2

2577F

AACATCTGCACCCAAGTGTACC

nsP2

3504R

GTCTCCTGTTGGCCGGTATAAT

8

nsP2

3332F

TAATAGGCCTGGAGGGAAGATG

nsP3

4134R

CTACGCACTCTTCATCGTTCTT

9

nsP2

3885F

GAACGAGTCATCTGCGTATTGG

nsP3

4725R

ATATCTCTGCCATATCCACTGC

10

nsP3

4458F

TCTTTACAGCCATGGACTCGAC

nsP4

5874R

TCTACTTTGCGCGACTGATACC

11

nsP4

5630F

CCCAGTATTCTTGGTTGCATG

nsP4

6380R

AAAACAGCACGCTTACCACG

12

nsP4

6184F

AAAACAGCACGCTTACCACG

nsP4

6936R

AACTTGAAGCGCGTACCTGTC

13

nsP4

6732F

TCATAGCCGCACACTTTAAGC

nsP4

7495R

AGGACCGCCGTACAAAGTTAC

14

nSP4

7278F

GCAGGTGACGAACAAGATGAG

C

8034R

CCGCTTAAAGGCCAATTTG

15

C

7910F

TCGAAGTCAAGCACGAAGG

E2

8670R

GTCTGTCGCTTCATTTCTGATG

16

E3

8459F

TGCTTGAGGACAACGTCATGAG

E2

9240R

TTTGTGATTGGTGACCGCG

17

E2

9093F

AGTCCGGCAACGTAAAGATCAC

6K

9861R

AAAGGTTGCTGCTCGTTCCAC

18

E2

9648F

AGTTGTGTCAGTGGCCTCGTTC

E1

10403R

TAAAGGACGCGGAGCTTAGCTG

19

E1

10145F

ACAAAACCGTCATCCCGTCTC

E1

11158R

TGACTATGTGGTCCTTCGGAGG

20

E1

10959F

CAGCAAGAAAGGCAAGTGTGC

3’NC

11802R

CTCCTACGTCCCTGTGGG

The primers for the fragment 1-19 and the forward primer for fragment 20 are used from the published primers [ 36 ] and the contrary primer for fragment 20 was designed in this survey.

Assembly of Genome Sequences and Sequence Analysis

The genome sequences were analyzed utilizing the BLAST plan available in GenBank ( hypertext transfer protocol: //blast.ncbi.nlm.nih.gov/Blast.cgi ) . Then they were edited and assembled by utilizing CHROMASLITE ( v.2.0 ) and SeqMan ( DNASTAR, Madison, Wis. , USA ) . All sequences were aligned by utilizing Clustal X version 1.83 and phyletic trees were constructed utilizing the neighbor-joining method and Kimura ‘s two-parameter with 1,000 bootstrapping method implemented in MEGA3.1 plan.

Consequence

Complete genome analysis of CHIKV in Thailand

We determined the about full-genome sequences of four CHIKV isolates which were representatives of 2008 and 2009 in Thailand and the inside informations are provided in table1. The lengths of genome sequence of four isolates presented in this paper were 11,811 base brace except isolate CU-ChiK661 was 11,738 base brace. Every isolates shared the same length of big two ORF ; non-structural part 7422 bases ( 2,474 aa ) and structural part 3744 bases ( 1248 aa ) and besides shared 65-nucleotide junction between these two open reading frame excepting stop codon of the non-structural of unfastened reading frame and get down codon of the structural unfastened reading frame. The 5’UTR ended at nucleotide place 62 for CU-ChiK661 and 76 for others. The 3’UTR part started at nucleotide place 11,299 for CU-ChiK661 and 11,314 for others. Then they were aligned with complete 23 genome sequences available in GenBank. Overall, genome constructions of these four isolates were consistent with old work [ 41 ] . The isolates in this survey were found really closely related demoing 99.79-99.89 % individuality with one another and had an mean whole genome nucleotide individuality of 97.0 % with the S27 paradigm. The isolate which were near related with our isolates was the isolate from Kerala, South India: RGCB80, Accession No.GQ428212 demoing an mean 99.72 % individuality.

The most closely related to S27 paradigm

CU-Chik661 was the closest one to S27 strain. In the non-structural part showed 34 aa alteration ( 1.37 % ) lined in nsP1 nine aa alteration ( 1.68 % ) , nsP2 6 aa alteration ( 0.75 % ) , nsp3 11 aa alteration ( 2.07 % ) , and nsP4 7 aa alteration ( 1.14 % ) . The nsP3 showed the highest ratio alteration while the nsP2 showed the lowest ratio alteration which correlated with old survey [ 36 ] . When it comes to structural part, ChiK661 exhibited 25 aa alteration ( 2.00 % ) arranged in C 3 aa alteration ( 1.15 % ) , E3 1 aa alteration ( 1.56 % ) , E2 15 aa alteration ( 3.55 % ) , 6K 2 aa alteration ( 3.27 % ) , and E1 4 aa alteration ( 0.91 % ) ( table3 ) .

Table 3 Comparison of amino acerb permutations identified in Thailand with that of S27 and other Indian isolates in 2007 and 2008

Region

polypeptide place

pritein place

S27

RGCB80/KL07

RGCB356/KL08

ChiK 661

Chik 9

Chik 10

Chik 683

nsp1

29

29

Phosphorus

.

.

.

.

Second

.

105

105

Gram

.

Roentgen

.

.

.

.

128

128

Thymine

K

K

K

K

K

K

172

172

Liter

Volt

Volt

Volt

Volt

Volt

Volt

186

186

Nitrogen

.

.

.

.

Calciferol

.

234

234

Tocopherol

K

K

K

K

K

K

256

256

Tungsten

.

Roentgen

.

.

.

.

376

376

Thymine

Meter

Meter

Meter

Meter

Meter

Meter

383

383

Meter

Liter

Liter

Liter

Liter

Liter

Liter

384

384

I

Liter

Liter

Liter

Liter

Liter

Liter

481

481

Thymine

I

I

I

I

I

I

488

488

Q

Roentgen

Roentgen

Roentgen

Roentgen

Roentgen

Roentgen

507

507

Liter

Roentgen

Roentgen

Roentgen

Roentgen

Roentgen

Roentgen

531

531

Calciferol

Gram

.

.

.

.

.

nsp2

583

48

Volt

A

.

.

.

.

.

589

54

Second

Nitrogen

Nitrogen

Nitrogen

Nitrogen

Nitrogen

Nitrogen

614

79

Phosphorus

.

.

.

.

Second

.

716

181

Volt

A

.

.

.

.

.

864

329

K

Tocopherol

.

.

.

.

.

909

374

Hydrogen

Yttrium

Yttrium

Yttrium

Yttrium

Yttrium

Yttrium

1074

539

Liter

Second

Second

Second

Second

Second

Second

1117

582

C

Yttrium

Yttrium

Yttrium

Yttrium

Yttrium

Yttrium

1118

583

Second

Nitrogen

Nitrogen

Nitrogen

Nitrogen

Nitrogen

Nitrogen

1328

793

A

Volt

Volt

Volt

Volt

Volt

Volt

nsP3

1428

95

K

Q

.

.

.

.

.

1508

175

Volt

I

I

I

I

I

I

1534

201

Second

.

Gram

.

.

.

.

1550

217

Yttrium

Hydrogen

Hydrogen

Hydrogen

Hydrogen

Hydrogen

Hydrogen

1659

326

Phosphorus

Second

Second

Second

Second

Second

Second

1664

331

Volt

A

A

A

A

A

A

1670

337

Thymine

I

I

I

I

I

I

1671

338

Thymine

.

.

.

.

Meter

.

1685

352

K

Tocopherol

Tocopherol

Tocopherol

Tocopherol

Tocopherol

Tocopherol

1709

376

I

Thymine

Thymine

Thymine

Thymine

Thymine

Thymine

1715

382

A

Thymine

Thymine

Thymine

Thymine

Thymine

Thymine

1794

461

Liter

Phosphorus

Phosphorus

Phosphorus

Phosphorus

Phosphorus

Phosphorus

1795

462

Second

Nitrogen

Nitrogen

Nitrogen

Nitrogen

Nitrogen

Nitrogen

1804

471

Phosphorus

Second

Second

Second

Second

Second

Second

nsP4

1938

75

Thymine

A

A

A

A

A

A

1945

82

Roentgen

.

.

.

.

Roentgen

.

1950

87

Yttrium

.

.

Hydrogen

.

.

.

2117

254

Thymine

A

A

A

A

A

A

2157

294

Volt

A

.

.

.

.

.

2363

500

Q

Liter

Liter

Liter

Liter

Liter

Liter

Region

polypeptide place

pritein place

s27

RGCB80/KL07

RGCB356/KL08

ChiK 661

Chik 9

Chik 10

Chik 683

nsP4

2377

514

I

Thymine

Thymine

Thymine

Thymine

Thymine

Thymine

2418

555

Volt

I

I

I

I

I

I

2458

595

Nitrogen

.

.

.

.

K

.

2463

600

Roentgen

.

.

.

.

I

.

2467

604

Volt

I

I

I

I

I

I

2468

605

Thymine

.

.

.

.

Second

.

2469

606

Liter

.

.

.

.

Meter

.

mirid bug

23

23

Phosphorus

Second

Second

Second

Second

Second

Second

27

27

Volt

I

.

I

I

I

I

28

28

Roentgen

.

Thymine

.

.

.

.

63

63

K

Roentgen

Roentgen

Roentgen

Roentgen

Roentgen

Roentgen

E3

284

24

I

Thymine

Thymine

Thymine

Thymine

Thymine

Thymine

290

30

K

.

.

.

Roentgen

.

.

E2

382

57

Gram

K

K

K

K

K

K

399

74

I

Meter

Meter

Meter

Meter

Meter

Meter

404

79

Gram

Tocopherol

Tocopherol

Tocopherol

Tocopherol

Tocopherol

Tocopherol

409

84

F

.

.

.

Liter

.

.

485

160

Nitrogen

Thymine

Thymine

Thymine

Thymine

Thymine

Thymine

489

164

A

Thymine

Thymine

Thymine

Thymine

Thymine

Thymine

506

181

Liter

Meter

Meter

Meter

Meter

Meter

Meter

519

194

Second

Gram

Gram

Gram

Gram

Gram

Gram

536

211

I

Thymine

Thymine

Thymine

Thymine

Thymine

Thymine

554

229

Volt

.

I

.

.

.

.

576

251

Roentgen

Roentgen

Roentgen

Roentgen

Roentgen

Roentgen

Roentgen

577

252

K

Q

.

Q

Q

Q

Q

592

267

Meter

Roentgen

Roentgen

Roentgen

Roentgen

Roentgen

Roentgen

624

299

Second

Nitrogen

Nitrogen

Nitrogen

Nitrogen

Nitrogen

Nitrogen

632

307

Q

.

.

.

Roentgen

.

.

637

312

Thymine

Meter

Meter

Meter

Meter

Meter

Meter

669

344

A

Thymine

Thymine

Thymine

Thymine

Thymine

Thymine

675

350

Gram

.

Second

.

.

.

.

700

375

Second

Thymine

Thymine

Thymine

Thymine

Thymine

Thymine

711

386

Volt

A

A

A

A

A

A

6K

756

8

Volt

I

I

I

I

I

I

802

54

I

Volt

Volt

Volt

Volt

Volt

Volt

813

65

Volt

.

A

.

.

.

.

E1

1035

226

A

Volt

Volt

Volt

Volt

Volt

Volt

1078

269

Meter

Volt

Volt

Volt

Volt

Volt

Volt

1093

284

Calciferol

Tocopherol

Tocopherol

Tocopherol

Tocopherol

Tocopherol

Tocopherol

1113

304

Phosphorus

.

Liter

.

.

.

.

1131

322

Volt

A

A

A

A

A

A

1242

433

C

Roentgen

.

.

.

.

.

Non-structural part

Compared to S27 and, the CU-Chik661, CU-Chik009, CU-Chik10 and CU-Chik683 isolates have shared 26 permutations in the non-structural part: nine in nsP1 ( T128K, L172V, E234K, T376M, M383L, I384L, T481I, Q488R, and L507R ) , five in nsP2 ( S54N, H374Y, C582Y, S582N, and A793V ) , eleven in nsP3 ( V175I, Y217H, P326S, V331A, T337I, K352E, I376T, A382T, L461P, S462N, and P471S ) and six in nsP4 ( T75A, T254A, Q500L, I514T, V555I, and V604I ) as shown in table3. Most of these alterations were besides found in other isolates from Indian Ocean and Reunion isolate in 2006 and 2007, isolates from Kerala, South India in 2006-2008 and other parts of the universe.

Interestingly, there was opal stop codon ( UGA ) at nsP3 codon 524 in the present isolates while S27 and Ross were non. This opal halt codon was besides observed in related alphavirus and old reported CHIKV isolates every bit good [ 35 ] . It is believed to modulate the look of nsP4, the putative RNA polymerase, by read-through mechanism [ 2, 39 ] Additional particular alterations were besides observed in ChiK10 ( nsP1-P29S, nsP1-N186D, nsP2-P79S, nsP3-T338M, nsP4-N595K, nsP4-R600I, nsP4-T605S, and nsP4-L606M ) and ChiK661 ( nsP4-Y87H ) . There was besides alone nucleotide permutation to the CU isolate which was non-synonymous alteration A6811G lined in nsP4 part.

Structural part

When analysing the amino acerb alteration of the structural protein 24 place were found to be common for the four isolates: three in C ( P23S, V27I and K63R ) , one in E3 ( I24T ) , 15 in E2 ( G57K, I74M, G79E, N160T, A164T, L181M, S194G, I211T, K252Q, M267R, S299M, T312M, A344T, S375T, and V386A ) , two in 6K ( V8I and I54V ) and four in E1 ( A226V, M269V, D284E, and V322A ) The lone one isolate which had specific alteration was ChiK009 demoing three specific aa place alterations ( E3-K30R, E2-F84L and E2-Q307R ) At the nucleotide place 9138, there was a alone event to the CU isolate demoing the same base as S27 and Ross strain while the remainder of other sequences antecedently reported had changed from T to C.

5 ‘ and 3 ‘ NTRs

The 5 ‘ NTR of all four isolates were found to portion similarity with one another uncovering the mutant at place 68 from G to T in comparing to S27 which were besides detected in all the recent isolates. Merely did CU-Chik10 hold a mutant at nucleotide place T64A. There was no interpolation or omission has been observed. Within the 3’UTR, sequences in this survey revealed the omission of a stretch 14 bases of 19 bases at place 11,369-11,342 compared to S27 except CU-Chik661 showed merely one A omission. This 14-A losing events besides showed in 2006 Indian Ocean isolates [ 35 ] .

Phylogenetic analyses

Fig.A1 illustrated the phyletic tree base on full genome analysis. CU isolates ( CU-Chik009, CU-Chik10, CU-Chik683 and CU-Chik661 ) arranged closest to isolates from Kerala, South India. Furthermore, they were crusted together with isolates during 2006 reunion eruption and 2007-2008 Indian eruption and related isolates. We besides determine extra E1 partial genome to analyse phyletic beginning as it is of import in phyletic analysis and there is more available sequence of this part including Asiatic and West-African strain. The phyletic tree based on E1 partial genome displayed in fig.A2. It revealed that all isolates in this survey were grouped in ECSA phylogroup. This determination was non the same phylogroup doing the eruption in 1958 in Thailand which was assigned in Asiatic strain.

Discussion

The first CHIKV described in Thailand was in 1958 in Bangkok [ 25 ] which was subsequently confirmed to be an Asiatic strain. [ 22 ] After that there were still a cyclicity of outgrowth of CHIKV in Thailand demoing a spread of 2-18 old ages: Prachinburi ( 1976 ) , Surinn ( 1988 ) , Khon Khen ( 1991 ) , Loei and Prayao ( 1993 ) , and Nongkhai and Nakorn Sri Thammaraj ( 1995 ) . During those outgrowths, the CHIKV all happened to be Asiatic strain [ 22 ] . CHIKV is presently doing one of the big eruptions reported in the past 50 old ages as in October 2008, bunch of febrility, roseola and terrible arthralgia was detected in one small town at Laharn wellness centre in Narathiwat and so chikungunya was suspected and confirmed subsequently. CHIKV has been distributing to next state of Narathiwat and the close state including Songkhla, Pattani and Yala by detecting several thousand instances reported in each country. Not merely has CHIKV been administering in the nearby country of Narathiwat but besides go arounding in the other parts of Thailand including sou’-east, cardinal, north and E of Thailand demoing more than 30,000 septic instances. The chief factor of distributing across the country is believed to be importing by travellers. This magnitude of the epidemics has arisen concernment of the public wellness of Thailand. As CHIKF was non a notifiable disease in Thailand, therefore the Bureau of Epidemiology had included CHIKF is the latest notifiable disease and launched in November 2008 ( inactive surveillance countrywide ; all gov. infirmaries and some private ) [ 40 ] .

This survey revealed the high degree of preservation of this RNA virus within a peculiar eruption that has been of considerable involvement during the patterned advance of 2008-2009 Thailand epidemics. As observed in old findings of samples collected during an on-its-own eruption, isolate sequences showed merely rare alterations stand foring expected degrees of familial impetus connected with an RNA genome. However, some given mutants were identified that may hold an association with samples collected from patients stand foring more terrible unwellness. Our survey represents the first analysis, to our cognition, of intra-outbreak of CHIKV in Thailand of the molecular degree. Our phyletic analyses placed on partial glycoprotein E1 sequences confirmed that CHIKV distributing in Thailand was caused by the same strain on Reunion, Seychelles, Mayotte, Madagascar, Mauritius, Indian Ocean, and India, and showed that this strain is related to East- , Central- and South-Africa isolates non the Asiatic strain as old eruption in Thailand. In add-on, E1-226 was the lone genotype observed during this eruption. Previous surveies showed that the mutant of amino residue 226 of E1 genome of SFV was observed to let go of the cholesterin dependance of the virus [ 41, 42 ] which might convey an advantage to virus in mosquitoes which are cholesterin auxotrophs, therefore CHIKV might hold the favour from this mutational alteration every bit good.

From all sequence of CHIKV except S27 and Ross strains have shown opal halt codon ( UGA ) at nsP3 codon 524. Restricting the figure of transitions is the key because the infecting viral population may maintain up a correspondence to a quasispecies [ 43, 44, 45 ] . Repeated in vitro transitions could move as a filter on this population. For case, the presence in S27 of an Arg codon alternatively of the opal halt codon in other isolates is possibly explained by legion in vitro transitions of S27, as development of opal to Arg was observed by experimentation in ONN viruses [ 46 ]

There is no aminic acid alteration detected among this eruption that is unambiguously associated with the Central/East African genotype from which the strain doing the 2008-2009 epidemics evolved. However, there are two alterations, one at the nsP2-L539S and one in the E2-K252Q that about alone to these isolates irrespective of three isolates from Kerala, South India, either alteration alters the hydrophobicity and charge of the amino acid incorporated but the biological relevancy of these alterations can merely be speculated. Chik10 had revealed the most alterations compared to three isolates and Chik10 was the lone sample collected in 2008 and it had specific alterations that have n’t shown in other isolates. Therefore those alterations might non remain circulate in this eruption or it was non the strain which predominate. Although CHIKV eruption has happened in Thailand since 2008, it is still ongoing circulate in several parts of Thailand so the farther probe should be considered.

How to cite this page

Choose cite format:

Chikungunya virus. (2017, Aug 20). Retrieved from https://paperap.com/paper-on-chikungunya-virus/

We will write a custom paper sample onChikungunya virusspecifically for you

for only $16.38 $13.9/page
Order now

Our customer support team is available Monday-Friday 9am-5pm EST. If you contact us after hours, we'll get back to you in 24 hours or less.

By clicking "Send Message", you agree to our terms of service and privacy policy. We'll occasionally send you account related and promo emails.
No results found for “ image
Try Our service

Hi, I am Colleen from Paperap.

Hi there, would you like to get such a paper? How about receiving a customized one? Click to learn more https://goo.gl/CYf83b